Pages

Friday, November 29, 2013

One giant step for me....(waiting for my giant leap)

Well....I'm still waiting on results and data but I have had a few successful steps but not enough to actually pull substantial data.  I think that we have come to the conclusion that the primers that I am running for my PCR are just not working.  The sequencing on the labels do not match the sequencing on the papers that they came with so....that is a problem.
Last week I blogged that I finally got some really great bands from my DNA extraction with the new extraction buffer that I made so that was a big step in the right direction.  Matt has given me some new primers, rice primers.  I had written about these in a previous blog.  They are called universal rice primers for the reason that they should work for just about anything.  But Matt has never used them on human DNA yet so again...I will be a bit of a pioneer in this field.  Today I am running a electrophoresis gel on the primers alone (well with Saber green, orange loading dye and a little DNase free water).  I have a total of 7 primers, so I will be able to see whether or not these are good to use on my project and also on future STEM PCR protocols.  If all 7 primers work, then I can get started on another round of PCR on Monday with the extracted DNA that I KNOW is gold.
Slowly but surely, I will succeed and get results.


As per ususal...
“The greater the obstacle, the more glory in overcoming it.”
― Molière

Tuesday, November 26, 2013

Science can be a real B...baffling that is

What can I say that I haven't already said about science?  This has really been a tough time for me with this experiment, but FINALLY I have had a actual breakthrough, thanks to Anil.  For those of you who don't know him, his is a professor here int he Bioscience department, he is kind, patient and brilliant.  It was his idea to go through all of the stock solutions that I was working with to see what they looked like.  I had been using a DNA extraction buffer that one of my fellow had made and there seems to have been some issues with that from the get-go.  There is a key element of the extraction buffer called EDTA, this comes in the form of a powder and a liquid.  The other student used the powder and created the solution and for some reason (either miscalculation or the age of the powder) my DNA was not reacting with the solution and I was not able to get any DNA bands.  Anil took one look at it and wanted me to start from the beginning and create a new extraction buffer.  This time we used EDTA premixed solution that we had in the fridge and DNase and RNase free water to make the buffer.  It was all smooth from there, the consistency of DNA when I placed it in my electrophoresis gel was different and I know from there that I was on the right tract.
It was like science magic, I got the bands that i had been hoping for, for weeks.  I was so excited and I shared my scientific elation to whom ever would listen!
Displaying IMG211.jpg  Displaying IMG195.jpg
As usual...my ending quote

Nobody trips over mountains.  It is the small pebble that causes you to stumble.  Pass all the pebbles in your path and you will find you have crossed the mountain.  ~Author Unknown

Thursday, November 14, 2013

The difference between try and triumph... is a little umph!!

Well it has only taken me 11 weeks but it has paid off.  I did it...finally, I successfully isolated genomic DNA from myself and two other lovely volunteers. I couldn't be happier, I was able to get results right before my rough draft of the final research paper was due, phew!!
This is my happy face
So my "eureka" moment came to me by the help of a few people, and it should have been something that we all caught earlier.  Matt, Anil, Josh and I were talking about the salt solution that I made for all of my subjects to swish with.  We all cringed at the taste and the couldn't get the salt out of our mouths after the rinse.  That should have been our clue!  I did my calculations incorrectly, I was having my subjects rinse with a 9% salt solution instead of a .9% WOW....what that was corrected it was like night and day.  I got a great DNA yield on my first try, I realize now that double checking my math with someone is probably a good idea seeing as math is not my strongest subject, my mental notes has been made!  The salt solution that I was having my subjects rinse in was actually degrading the DNA molecules before I even started my wizard protocol.






I would like to take a moment to give a shout out to my main professor....Anil Kapoor.  With out his guidance, I don't think that I would have been able to run my PCR.  Matt H, you have been a great help as well but I know that you have been swamped.  Anil took the time to go step by step with me in the PCR process and it was awesome.

So my PCR process went like this:
 First I diluted my original ALU primer sequence solution into two different epindorph tubes, one for stock and the other a working solution.  The stock was diluted ten times(so I have plenty for back up)  and the working solution was a dilution of the stock which I diluted another 10 times.  The primer looks for the forward base pair sequence of GTAAGAGTTCCGTAACGGACAGCT and the reverse primer looks for the base pairs of CCCCACCCTAGGAGAACTTCTCTTT.  (If you remember from about 9 weeks ago, I did a blog on how the primer PCR sequence works.  These are the base pairs that attach to the separated DNA in order to replicate and elongate the DNA sequence) .
From there, I added 90 um of clean DNase water and 10um of my ALU forward primer into one tube and the the same for the ALU reverse, then I added my 2 um of my original student sample, and added 62.5 um of 'Dream green Mastermix" primer and aliquot-ed that into to tiny PCR tubes and placed them into the T1000 Thermocycler and programmed it to the following specification:

Cycle 1 runs for 3 minutes at 95 degrees C
Cycle 2 runs for 30 seconds at 95 degrees C
Cycle 3 runs for 40 seconds at 58 degrees C
Cycle 4 runs for 1 minute at 72 degrees C
Then the process of cycle 2-4 repeat themselves 34 times
Cycle 5 runs for 10 minutes at 72 degrees C.

This whole process take anywhere from 2-4 hours

Thermocycler doing its thang!!

 I will get together will Anil tomorrow to run another electrophoresis gel from my PCR amplification!!

I had so much to write about today...with that I had gotten this results weeks ago but better late then never!!!

As always. I will end this entry with a very fitting quote

“Never give up, for that is just the place and time that the tide will turn.”

Harriet Beecher Stowe (1811-1886);

Thursday, November 7, 2013

I give myself an A for effort!!

I am not usually this terrible at something that I try so hard to accomplish, but I guess when I fail...I fail hard!
Yet again, I have been unsuccessful at isolating DNA from my samples, so I have not had a good gel yet and I still have not run PCR (Grrrrrrrrr!). 

I noticed that last week a few things has gone wrong with my setup during the electrophoresis phase of my experiment.  About 15 minutes after I turned on my power source (to 120 volts), it just turned off, for no apparent reason.  The good thing is that I was there to see it and turned it back on right away.  I wasn't sure if that glitch was going to affect my results but it actually did.  My DNA started to diffuse backwards onto my gel.  I should have learned my lesson that time, but I used the same rig and power source again.  When the same thing happened, I actually stated to get excited.  Maybe this was my problem all along...my power source, not an ID10T error.  So this week, I stated fresh, with a new rig and new power source for my electrophoresis set up.


Yesterday I sat in Anil's class as he taught BIO 160 and ran my entire protocol from start to finish.  I thought that if I was there he would be able to help me along the way (without disrupting his class of course), and maybe just the change in atmosphere would yield better results  :o(

Nada....

I was really starting to get frustrated, especially as the rough draft for my research paper is coming up soon.  I was tired of the weeks of disappointment, so this morning I spoke to Josh and Matt and they made me feel a little bit better about myself and my (lack of ) progress.   This is the first time that anyone here in the STEM program has used this  protocol that I am using to extract human DNA (Gilbert is using the same protocol but on fruits and veggies and the yield of genomic DNA is like 1000 times grater then human), so I guess it is to be expected that I am the trial and error gal for this project.  I also learned that two other STEM students from last semester tried and only one person really got results.  She had a very well established protocol and all of the kinks had already been ironed out for her but even then, she was still only able to produce quality DNA about 70% of the time. So, try again...I will.

“To conquer frustration, one must remain intensely focused on the outcome, not the obstacles.”
― T.F. Hodge