The difference between try and triumph... is a little umph!!

Well it has only taken me 11 weeks but it has paid off.  I did it...finally, I successfully isolated genomic DNA from myself and two other lovely volunteers. I couldn't be happier, I was able to get results right before my rough draft of the final research paper was due, phew!!

This is my happy face

So my "eureka" moment came to me by the help of a few people, and it should have been something that we all caught earlier.  Matt, Anil, Josh and I were talking about the salt solution that I made for all of my subjects to swish with.  We all cringed at the taste and the couldn't get the salt out of our mouths after the rinse.  That should have been our clue!  I did my calculations incorrectly, I was having my subjects rinse with a 9% salt solution instead of a .9% WOW....what that was corrected it was like night and day.  I got a great DNA yield on my first try, I realize now that double checking my math with someone is probably a good idea seeing as math is not my strongest subject, my mental notes has been made!  The salt solution that I was having my subjects rinse in was actually degrading the DNA molecules before I even started my wizard protocol.

I would like to take a moment to give a shout out to my main professor....Anil Kapoor.  With out his guidance, I don't think that I would have been able to run my PCR.  Matt H, you have been a great help as well but I know that you have been swamped.  Anil took the time to go step by step with me in the PCR process and it was awesome.

So my PCR process went like this:
 First I diluted my original ALU primer sequence solution into two different epindorph tubes, one for stock and the other a working solution.  The stock was diluted ten times(so I have plenty for back up)  and the working solution was a dilution of the stock which I diluted another 10 times.  The primer looks for the forward base pair sequence of GTAAGAGTTCCGTAACGGACAGCT and the reverse primer looks for the base pairs of CCCCACCCTAGGAGAACTTCTCTTT.  (If you remember from about 9 weeks ago, I did a blog on how the primer PCR sequence works.  These are the base pairs that attach to the separated DNA in order to replicate and elongate the DNA sequence) .
From there, I added 90 um of clean DNase water and 10um of my ALU forward primer into one tube and the the same for the ALU reverse, then I added my 2 um of my original student sample, and added 62.5 um of 'Dream green Mastermix" primer and aliquot-ed that into to tiny PCR tubes and placed them into the T1000 Thermocycler and programmed it to the following specification:

Cycle 1 runs for 3 minutes at 95 degrees C
Cycle 2 runs for 30 seconds at 95 degrees C
Cycle 3 runs for 40 seconds at 58 degrees C
Cycle 4 runs for 1 minute at 72 degrees C
Then the process of cycle 2-4 repeat themselves 34 times
Cycle 5 runs for 10 minutes at 72 degrees C.

This whole process take anywhere from 2-4 hours

Thermocycler doing its thang!!

 I will get together will Anil tomorrow to run another electrophoresis gel from my PCR amplification!!

I had so much to write about today...with that I had gotten this results weeks ago but better late then never!!!

As always. I will end this entry with a very fitting quote

“Never give up, for that is just the place and time that the tide will turn.”

Harriet Beecher Stowe (1811-1886);