This is it....the end of an era.

Well this is a bitter sweet blog for me as this will be my last entry.  I will graduate on the 13th of this month and the era of PC life will be over for me.

I'd like to start by thanking a few key people, without whom, parts of this journey would not be possible.
Amanda Chapman - You took a chance on me a few semesters ago and picked me to be your intern after excelling in your Bio class.  I have shared a lot of my personal life with you, we have a lot in common and I think that helped our relationship, both professional and personal.  You put your trust in me and my abilities and I know without any doubt, I have not let you down.  I will miss our little chats in your office and reporting my finding (and lack there of) and getting great feedback from you.  Thank you

Josh and Matt - You guys are great, what else can I say.  You bring life and energy into the Bioscience department and you are always there to help.  Matt, you have spent a lot of time helping me, especially this semester on my project, and helped me stay focused even when I felt like giving up.  Your stories and genuine interest in my life and success has been instrumental in my journey.   Josh, your music and overall coolness always put a smile on my face and I'm glad that I had a chance to get to know you.  I think that my math conversion will stay with me as you always made me think and never just gave me the answer to a problem, and made me realize my full potential.

Djiana - Your smile and encouragement is contagious.  You are a beautiful soul and the have the patience of a saint!  I can't count the number of times that I've needed your help with my blog or to fix my time sheet!   You keep your cool and no matter what, you help everyone and treat us all with respect and you always see the good side.  You have boosted my self esteem and made me look at myself in the mirror and be proud of what I see and what I have accomplished.

Jeremy - My buddy, my friend (tear).  I don't think that I could have survived STEM without you.  I always knew when you were in the office...I smelled the sweet smell of you from a mile away!  We have shared so many laughs and good times that I can't put a number on them.  Vous êtes un ami incroyable et je vous remercie d'être là pour moi et l'écoute de toutes mes histoires. Je m'ennuierai vous et notre camaraderie. Vous êtes un grand personnage avec un potentiel incroyable. Séjour génial.

To all my other STEM buddies - I wish that I more time to get to know all of you.  I'm so glad to have met you and I wish you all the best of luck in all of your future endeavors.  Stick with the STEM program, it is really something that will propel us all to the next level and something that we will never for get.

I thought long and hard about my last STEM blog quote:

Destiny is not a matter of chance, but choice, not something to wish, but to attain.

Good luck and happy holidays from my family to yours.

The Goolsby-Espinosa Family

One giant step for me....(waiting for my giant leap)

Well....I'm still waiting on results and data but I have had a few successful steps but not enough to actually pull substantial data.  I think that we have come to the conclusion that the primers that I am running for my PCR are just not working.  The sequencing on the labels do not match the sequencing on the papers that they came with so....that is a problem.
Last week I blogged that I finally got some really great bands from my DNA extraction with the new extraction buffer that I made so that was a big step in the right direction.  Matt has given me some new primers, rice primers.  I had written about these in a previous blog.  They are called universal rice primers for the reason that they should work for just about anything.  But Matt has never used them on human DNA yet so again...I will be a bit of a pioneer in this field.  Today I am running a electrophoresis gel on the primers alone (well with Saber green, orange loading dye and a little DNase free water).  I have a total of 7 primers, so I will be able to see whether or not these are good to use on my project and also on future STEM PCR protocols.  If all 7 primers work, then I can get started on another round of PCR on Monday with the extracted DNA that I KNOW is gold.
Slowly but surely, I will succeed and get results.

As per ususal...
“The greater the obstacle, the more glory in overcoming it.”
― Molière

Science can be a real B...baffling that is

What can I say that I haven't already said about science?  This has really been a tough time for me with this experiment, but FINALLY I have had a actual breakthrough, thanks to Anil.  For those of you who don't know him, his is a professor here int he Bioscience department, he is kind, patient and brilliant.  It was his idea to go through all of the stock solutions that I was working with to see what they looked like.  I had been using a DNA extraction buffer that one of my fellow had made and there seems to have been some issues with that from the get-go.  There is a key element of the extraction buffer called EDTA, this comes in the form of a powder and a liquid.  The other student used the powder and created the solution and for some reason (either miscalculation or the age of the powder) my DNA was not reacting with the solution and I was not able to get any DNA bands.  Anil took one look at it and wanted me to start from the beginning and create a new extraction buffer.  This time we used EDTA premixed solution that we had in the fridge and DNase and RNase free water to make the buffer.  It was all smooth from there, the consistency of DNA when I placed it in my electrophoresis gel was different and I know from there that I was on the right tract.
It was like science magic, I got the bands that i had been hoping for, for weeks.  I was so excited and I shared my scientific elation to whom ever would listen!
 
As usual...my ending quote

Nobody trips over mountains.  It is the small pebble that causes you to stumble.  Pass all the pebbles in your path and you will find you have crossed the mountain.  ~Author Unknown

The difference between try and triumph... is a little umph!!

Well it has only taken me 11 weeks but it has paid off.  I did it...finally, I successfully isolated genomic DNA from myself and two other lovely volunteers. I couldn't be happier, I was able to get results right before my rough draft of the final research paper was due, phew!!

This is my happy face

So my "eureka" moment came to me by the help of a few people, and it should have been something that we all caught earlier.  Matt, Anil, Josh and I were talking about the salt solution that I made for all of my subjects to swish with.  We all cringed at the taste and the couldn't get the salt out of our mouths after the rinse.  That should have been our clue!  I did my calculations incorrectly, I was having my subjects rinse with a 9% salt solution instead of a .9% WOW....what that was corrected it was like night and day.  I got a great DNA yield on my first try, I realize now that double checking my math with someone is probably a good idea seeing as math is not my strongest subject, my mental notes has been made!  The salt solution that I was having my subjects rinse in was actually degrading the DNA molecules before I even started my wizard protocol.

I would like to take a moment to give a shout out to my main professor....Anil Kapoor.  With out his guidance, I don't think that I would have been able to run my PCR.  Matt H, you have been a great help as well but I know that you have been swamped.  Anil took the time to go step by step with me in the PCR process and it was awesome.

So my PCR process went like this:
 First I diluted my original ALU primer sequence solution into two different epindorph tubes, one for stock and the other a working solution.  The stock was diluted ten times(so I have plenty for back up)  and the working solution was a dilution of the stock which I diluted another 10 times.  The primer looks for the forward base pair sequence of GTAAGAGTTCCGTAACGGACAGCT and the reverse primer looks for the base pairs of CCCCACCCTAGGAGAACTTCTCTTT.  (If you remember from about 9 weeks ago, I did a blog on how the primer PCR sequence works.  These are the base pairs that attach to the separated DNA in order to replicate and elongate the DNA sequence) .
From there, I added 90 um of clean DNase water and 10um of my ALU forward primer into one tube and the the same for the ALU reverse, then I added my 2 um of my original student sample, and added 62.5 um of 'Dream green Mastermix" primer and aliquot-ed that into to tiny PCR tubes and placed them into the T1000 Thermocycler and programmed it to the following specification:

Cycle 1 runs for 3 minutes at 95 degrees C
Cycle 2 runs for 30 seconds at 95 degrees C
Cycle 3 runs for 40 seconds at 58 degrees C
Cycle 4 runs for 1 minute at 72 degrees C
Then the process of cycle 2-4 repeat themselves 34 times
Cycle 5 runs for 10 minutes at 72 degrees C.

This whole process take anywhere from 2-4 hours

Thermocycler doing its thang!!

 I will get together will Anil tomorrow to run another electrophoresis gel from my PCR amplification!!

I had so much to write about today...with that I had gotten this results weeks ago but better late then never!!!

As always. I will end this entry with a very fitting quote

“Never give up, for that is just the place and time that the tide will turn.”

Harriet Beecher Stowe (1811-1886);

I give myself an A for effort!!

I am not usually this terrible at something that I try so hard to accomplish, but I guess when I fail...I fail hard!
Yet again, I have been unsuccessful at isolating DNA from my samples, so I have not had a good gel yet and I still have not run PCR (Grrrrrrrrr!). 

I noticed that last week a few things has gone wrong with my setup during the electrophoresis phase of my experiment.  About 15 minutes after I turned on my power source (to 120 volts), it just turned off, for no apparent reason.  The good thing is that I was there to see it and turned it back on right away.  I wasn't sure if that glitch was going to affect my results but it actually did.  My DNA started to diffuse backwards onto my gel.  I should have learned my lesson that time, but I used the same rig and power source again.  When the same thing happened, I actually stated to get excited.  Maybe this was my problem all along...my power source, not an ID10T error.  So this week, I stated fresh, with a new rig and new power source for my electrophoresis set up.

Yesterday I sat in Anil's class as he taught BIO 160 and ran my entire protocol from start to finish.  I thought that if I was there he would be able to help me along the way (without disrupting his class of course), and maybe just the change in atmosphere would yield better results  :o(

Nada....

I was really starting to get frustrated, especially as the rough draft for my research paper is coming up soon.  I was tired of the weeks of disappointment, so this morning I spoke to Josh and Matt and they made me feel a little bit better about myself and my (lack of ) progress.   This is the first time that anyone here in the STEM program has used this  protocol that I am using to extract human DNA (Gilbert is using the same protocol but on fruits and veggies and the yield of genomic DNA is like 1000 times grater then human), so I guess it is to be expected that I am the trial and error gal for this project.  I also learned that two other STEM students from last semester tried and only one person really got results.  She had a very well established protocol and all of the kinks had already been ironed out for her but even then, she was still only able to produce quality DNA about 70% of the time. So, try again...I will.

“To conquer frustration, one must remain intensely focused on the outcome, not the obstacles.”
― T.F. Hodge

My small step for science-kind

Well this week has been a little better then the last but I still have not gotten the results that I had initially hoped for, but the is the definition of science, right??
Actually, the definition of science, according to Webster, is "the intellectual and practical activity encompassing the systematic study of the structure and behavior of the physical and natural world through observation and experiment.". 

www.npr.org

 I've been doing a ton of experimentation but if nothing else, I'm fine tuning my DNA extraction skills, and in my field, that is never a bad thing. 

So this week there really isn't a whole lot of new progress but I have altered my protocol a bit.  I have increased my original DNA in salt solution sample.  Thanks to Anil, who gave me some valuable advice, I took 1.5 uL of each sample, spun it down, then I added another 1.5 uL of solution and spun in down again to maximize the amount of DNA. 

I think that my problem this week is that my samples are not longer viable, they may be too old.  So today, I'm hoping to start some new solutions with samples from my fellow students.  But I did make some progress, I got one really bright band from a member of our Bioscience staff, I was able to reproduce it twice so I know that I am on the right track.  Below are a few photos of my some-what-successful electrophoresis gels.

The bright orange band is the best sample that I have gotten so far

This is my desired results. 

The STEMamiga's

Yea!!  There are signs of new life....in the form of new STEM students and I'm excited.  Not that I'm complaining about the old blood that's been flowing around here for the past few months, (actually semesters) but the new gang seems like they are going to all fit right in, ESPECIALLY my new girls!!  I've racked my brain for this one (so hold on...its a real knee slapper....if you were born in the '70's or early 80's) but seeing as we are females are an uncommon species this time around in STEM, I unofficially named us The Three STEMamigas!

craveonline.com

BUT like so many things in my life this week, this didn't work out.  On the bright side, I've been told that there are 5 lovely ladies this semester, I can't wait to meet you all :o)

The other thing that didn't go well this week was my DNA extraction.  I tried using a new protocol that Gilbert and Matt had been working on.  To tell you the truth, I was really excited to use some advanced techniques to extract my DNA as my rudimentary soap extraction was not that high-tech.  I had my victims wash out their mouths out with a intense salt rinse for about 45 seconds and politely split the solution into a cup.

Me and my salt rinse

With the help of a kit from Promega called the "Wizzard DNA Clean-Up System" I added a resin that helps separate the DNA from the rest of the materials (frosted flakes, muffins...breakfast).  I added 1ml of the resin to Micro centrifuge tubes and added 50 uL of DNA solution, inverted the tube a few times to let the resin bind to the DNA.  Then I attached a lure lock syringe to a minicolum (which as a filter to catch the DNA.  The solution was pushed through the filter then I added 2mL of 80% isopropanol alcohol to the syringe and pushed that through the filter to clean the DNA and spun it in the centrifuge for 2 minutes on high.  I added 50uL of warm DI water and tel that soak into the filter for about 2 minutes then spun it again.  I was left with about 60 uL of a "pure" DNA solution...or was I???  I had my electrophoresis gel all ready to go and added my control sample and volunteer samples into the gel wells with the correct amount of orange loading dye and saber green.  I ran it at 120volts for 45 minutes while I was in class.  I was pumped when I got back to see what kind of bands were on my gel, but it was a bust!  I looked at my gel under the UV light box and only saw my control band.  Sigh....all that work for naught :o(

But I will try again tomorrow...so I'll be coming for all of you with salt water in hand!!!

I wanted to end this weeks blog with a great quote:

Remember that guy that gave up? Neither does no one else.

– Unknown

Looking for volunteers....You should probably inquire first before you say yes!!

“Three things you cannot recover in life: the WORD after it’s said, the MOMENT after it’s missed and the TIME after it’s gone. Be Careful!” – Unknown

I think that this quote is fitting seeing as we are all hitting midterms and we are really into the "meat and taters" of the semester...that said, putting the time and effort into S-STEM sometimes seems like the cherry on top of the cake that is on top of the pile of books, the mountain of papers, which is on the TI-84 calculator, on the beaker full of acetone, which is balancing on the broom.  But it can be done....trust me.

I am running another experiment this week in order to collect my DNA and run my PCR.  I am going to enlist the help of Anil to do so as he is the resident PC PCR expert (toot toot!!).   Once this is completed, I'd like to get one of my fellow STEM buddies to do a salt rinse so that I can collect their DNA.  I would really like to do a comparison to see what STR's that we may have in common.  STR stands for "Short Tandem Repeat", it is an analysis is a relatively new technology in the area of forensic science, which many of you may know is my major, and it is very up and comming. It has been recently identified as “genetic fingerprinting.” Results from this analysis are most often used in the identification of a suspect in a crime. These results are input into the Combined DNA Index System (CODIS) for matching purposes. CODIS is an FBI-funded computer database, which stores the DNA of convicted sex offenders, convicted murderers, certain felony offenders and other criminals.  So if my volunteer fits any of these categories....you may want to rethink giving me your DNA!!  Kidding, I'll be keeping it off the FBI database, I promise.

www.le.ac.uk

STRs are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times in a head-tail manner, i.e. the 16 bp sequence of "gatagatagatagata" would represent 4 head-tail copies of the tetramer "gata". The polymorphisms (variations in DNA sequence between individuals) in STRs are due to the different number of copies of the repeat element that can occur in a population of individuals. (Criminalistics: An Introduction to Forensic Science, R. Saferstein)

Any takers????

Viruses, alive or not alive....that is the question

Let’s first define life. According to the online Webster's dictionary, life is “an organismic state characterized by capacity for metabolism, growth, reaction to stimuli, and reproduction.”
Grrr....So I guess I was wrong, viruses are not living things. Viruses are complicated assemblies of molecules, including proteins, nucleic acids, lipids, and carbohydrates, but on their own they can do nothing until they enter a living cell. Without cells, viruses would not be able to multiply. Therefore, viruses are not living things.
But viruses are stilling of the fence of the definition of life. They lie somewhere between complex molecules and very simple biological units. Viruses contain some of the structures and exhibit some of the activities that are common to organic life, but they are missing many of the others. So in a nut-shell, viruses are entirely composed of a single strand of genetic information encased in a protein capsule. Viruses lack most of the internal structure which define 'life', including the organ structures that are necessary for reproduction. In order for a virus to replicate or multiply, it must first infect a suitable host cell.

So I stand corrected...or do I??

There is still a debate that flip flops in the scientific world, that viruses are thought of as being in a gray area between living and nonliving, so it really depends on who you ask!!!
Jeremy and I had a nice little conversation about this today so I thought it was fitting to address in this weeks blog.

And, for your viewing pleasure, here are two hand drawn (by me of course) examples of viruses.

I'm back baby...better late then never

Hello STEM family,

I know, I know..I've been away for the last week recovering from surgery but glad to report that I'm on the mend.

In my down time (only when the vale of pain meds had lifted), I read some really great articles on viral DNA in the human genome and what is actually does and how through Bioinformatics, viruses are being tracked .  I'll report on some of that later this week but today (better late then never) I wanted to give you a little bit of insight on viruses.

Viruses are actually the smallest living thing known to man.  We all know of and we have all has small and quite simple viruses like the cold or a flu, but viruses cause a wide range of disease, a lot of them being deadly.
When we think about it, viruses have been around for a long time, maybe even as long as the first humans inhabited the earth.  One can say that we, humans are all actually part virus.  The human genome contains more DNA from viruses then the DNA that makes up our own genes.  Scientists have identified thousands of segments of retroviruses (A retrovirus is a virus whose genes are encoded in RNA instead of DNA) DNA in our genes, which make up about 8% of the human genome.
Human genome DNA and viral DNA contain segments.  According to an article written by Carl Zimmer, three of these segments that are shares are gag - which is where virus genes or genetic make up are stored, env - the knobs that appear on the surface of the virus that allows the virus to attach itself to the non infected cell in order to invade said cell and pol which creates the enzyme that inserts the virus genes into the host cell DNA.  Together, these segments invade viable cells where they are replicated and multiply at alarming rates causing rapid decline in a number of hosts, such as cancer and aids patients. 

www.dna.org

 

Self-doubt kills talent

Self doubt kills talent and yesterday...it almost killed my experiment!
I'm not too sure why it happens but I'm getting better at recognizing it!

This week, I was able to get my own personal DNA extracted from buccal cells and started a very rudimentary version of my DNA extraction experiment.  I wanted to be sure that I could pull it off before I started with the really expensive materials that were ordered for my experiment.  It took me 3 tries to get my gel for the electrophoresis set up correctly, but you know what they say, the third time is the charm! 

I followed an old protocol that I had from last semester for running the gel.  I made my control dye which consisted of 9 um (microliters) of molecular mass ruler and 1 um of SYBR green nucleic acid gel stain and added it to my first well of the gel.  Then, with three different buccal samples, I added 9 um of the extracted DNA, 1 um of SYBR green and 2 um of orange loading dye. I placed them in wells 3, 5 and 7 and filled the electrophoresis rig with 1x TAE buffer solution, hooked it up to the voltage machine and ran 120 volts through it for 40 minutes.

This is what my gel looked like when it was finished and it is also where my doubt set in!

(the blue color is my control and the 3 faint orange colors are from the orange loading dye)

Maybe I have been watching too many episodes of CSI but some some reason I was expecting to see dark bands of DNA that ran down my gel.  I felt defeated to say the least and I was about to toss out my gel when Josh told me to have Matt take a look at it.  It was perfect timing as Matt and Anil were talking and they came over to see my progress and boy....does it pays to ask the experts!  It worked!!  The bands that I was expecting to see would not show up until I ran my actual PCR, (phew).  Anil put my gel in the Bioimaging system which shines a UV light onto the gel in order for the maker, DNA and loading dyes to glow.

This is what was produced:

 (On the left side of the gel you can see 3 bright bands towards the top, that is my DNA, they are glowing).

From here, my next step will be to run the PCR and amplify (or copy) the DNA sequence from those samples.  It is from that process, that I will be able to see the rows of dark bands form on a similar gel.

What is PCR and how does it work

Happy Thursday everyone!!

I have been doing a lot of research on my project as I have been waiting for the rest of my supplies to come in (which, I'm excited to report that they are almost all in, thanks Matt!!).  One of the most important process's to my project is called PCR, Polymerase Chain Reaction.

So what is PCR?  Well it is the process of replicating or copying a small portion of a single side of the DNA double helix, outside of the body.  Sounds complicated right??  Well our body makes copies of existing cells every single day and I have been given a great protocol  to do this. 

The process beings with unwinding the DNA double helix, because as you all know, it is in a ladder shape and it is coiled extremely tight so a process of 'melting' must take place.  Where the twisted ladder is uncoiled to look like a regular ladder by adding primers and reagents to the sample.  The sample is then heated and the weak hydrogen bonds are broken and the ladder-like structure splits down the middle making two single strands.  The mixture now needs to be cooled (called the anneal process).  According to Saferstein, a primer is added to the mixture which are short sequences of nucleotides, (pg. 270 Criminalistics: An Introduction to Forensic Science) that attach to the beginnings of the separated single strands of DNA.  This is where the replication process begins and complete copies of DNA are formed. The last stage is the extension stage where the mixture is heated again and enzymes attach to the complimentary base pairs of DNA (Adenine, Thymine, Cytosine and Guanine).

Here is my illustration of how this process works.

Preperation is key

As some of you may know, I am majoring in forensic science.  It is such a relatively new and fantastic field and I am so excited to be a part of it and extremely proud to be doing so well in it.  I have been looking for jobs in the area for when I graduate and I am so thankful that I will have a leg up on the competition, due to the experience and knowledge that I have/will gain here in the Biosciecne department.  As I look around my classrooms, I see all of the people that I will be competing against for jobs.  It is a competitive field, thanks to Hollywood's crime drama's like CSI.  I am certain that the experiments and daily functions that I preform here in the bio lab have prepared me well enough that in conjunction with my grades, I will be in shoe-in for a great career. 

This semesters project, Viral DNA in human genome, will solidify all that I have been working towards for the past 3 years.  The extraction, identification, and processing of human DNA is something that I hope to be doing on a daily basis when I finish here at PC and I will already have the background knowledge and the hands-on experience from here that I know, no one else will have .  I am really excited.  I have given a list of items to Matt to look into ordering and/or getting the recipes for some of the items that we do not have on hand in the lab, so as soon as it comes in, I can dive in to my experiment.  But for the time being, I am doing a lot of my research and setting up my work area, so that I can be as organized and effective as possible.

I'm going viral...viral DNA

Hello everyone!! 

I'm so excited to start off this semester in S-STEM, I learned so much last term and I have no doubt that this term will be no different.  I met with Josh and Matt and went through all of the topics and idea's that they have complied for STEM projects.  I was debating whether or not to continue my last project (The succession of pond water communities, as it was extremely interesting) but decided to venture out and do something new.  As I am a forensic's major, Matt and I looked to see what would best fit my discipline as far as real world applications and we happened upon "Viral DNA in Human Genome".  So, yes, I'm going viral and I can't wait!!

The basic premise for my study will be to extract human DNA (by way of buccal or cheek cells swabs) from different people with different ethnic backgrounds.  I will extract the DNA and plot my findings using gel electrophoresis, to identify the different genetic markers/traits that are held by different ethnicities.

So in the spirit of discovery and competition, I wish all of my peers good luck and happy findings for this semester. I look forward to meeting all of the new interns and to reconnect with all of my ol' STEM buddies. I can't wait to get past my research phase and dig in! 

Updated Bio 2013

Bio

Hi, my name is Jervana Goolsby and I am an intern here at PC.  I started my internship after my BIO 160 class with Amanda Chapman, in September 2012 and I have been given the opportunity to participate for a second term.

When I was a little girl my mother worked as a lab technician at the Toronto Hospital in Ontario Canada.  I remember going to the lab every chance I got.  I was fascinated by the atmosphere, the equipment and the experiments that took place there and I knew that when the time was right, I'd find myself working in the same atmosphere.  This was just a preview of what was to come for me.

Sad to say that my dream job was put on hold as I unexpectedly became a mother (which turned out to be another great moment in my life...twice).  But as motherhood flourished my dreams took a back seat.   A difficult circumstance came about with my daughter, who was 4 at the time, which made me look at my life and where I was headed.  At the time...I was headed nowhere a little too fast for my liking, time was slipping away and I knew that I had to do something more beneficial for my children and myself. So I decided to put my brain back to the test and enroll in school.  It is one of the best decisions that I have made in a long time.  I started my college career at the age of 30...better late then never I always say!

As the semesters went by, I became more and more confident in my abilities as a mother, student and peer mentor.  My grade steadily increased until I reached the status of Phi Theta Kappa and became a member of the prestigious Presidents club at PC for achieving straight A's, two semesters in a row.  I was also awarded the Wilma Ulrick memorial scholarship this semester, so I am finishing out my college career sure strong!
I am determined to be the best example that I can for my children and others around me.  It has been a difficult road for me personally but this internship has opened my eyes to my own possibilities, possibilities that I always knew were there but that had been suppressed for one reason or another.

I will be graduating at the end of this semester (YEAH!!), which is a great personal accomplishment for me and for my family as I will be the first one in my family to graduate from College.  I would like to thank all of my family, my boyfriend Tomas, my friends and all my teachers that believed in me and helped my reach my potential.  Also a special thanks to Amanda Chapman for taking a chance on me and giving me this opportunity.

I can't wait to see what project will be assigned to me this year!!

No ending in sight

NO END IN SIGHT

Well this last blog is bitter sweet.  It has been a challenging semester but as we near the home stretch, the finish line is well within my view.  I had 3 finals today before noon, so I'm pooped but caffeinated, still going but running on fumes!  I got my first final grade today, an A of the semester and if everything goes according to plan, that is the first of 5 A's.

As for my project...the succession doesn't seem to be anywhere near the finish line!

The mass amounts of diatoms that were once the most abundant in my specimen jar are all but a distant memory.  I have found a few here and there but they are now in my 'rare' category, now the algae (green and blue-green) have taken over and are in the 'abundant' group, I found more Rotifers and a bunch more nematodes.  I have a few photos of the nematodes but those suckers more so fast that it is hard to get a good picture so these are the best ones.

It is really hard to give a conclusion or a final summary of my findings as my project is still on going, what I can conclude with that a hay infusion is a great way to produce a variety of microbes. The sugars in the dried grass provide food for the bacteria and other microbes. The bacteria serve as food for the protozoa. If the bacteria grow quickly, the protozoa will also grow quickly. The protozoa breathe oxygen so it is important to pump air into the hay infusion.  The longer the succession the more complex the microbes become from yeast/fungus, protists/amoeba, green and blue-green algae, desmids, diatoms, protozoans, rotifers to miscellaneous invertebrates.
I was able to create an entire population under the right conditions, who knows where it will lead me?

Down to the wire

Well folks...after tomorrow there are exactly two weeks left of the semester!  Where did the time go?  Estrella Mountain conference is just around the corner as is the Metro tech presentations on the last day of school.  I see everyone getting their projects wrapped up so that posters can be made and presentations in order.  I must say that this semesters interns have done a great job.  I think that we have all been fortunate to see the progress of all our peers, to interact and to learn with one another.

                                                                         An Algae Smile
                   
Well surprise again....I took samples of my water today and although I did have many more nematodes and a ton of green and blue-green algae, one factor that is missing this time around are my diatoms.  I'm am guessing that they have hit their peak (oh somewhere between day 71 and today (day 78) and died off.  I'm going to test my theory again tomorrow and pull some more samples to see if I was just unlucky in my water selection.  Its amazing...Diatoms commanded such a presence for most of my experiment and now, they are just gone.  I guess that is the whole point of this experiment.  To see the succession of microbes, the rise and fall of different species found in pond water.  I'm a bit sad to see them all just disappear, they were my first "cool" discovery but I guess nematodes are more interesting as they are way more complex.  The only thing about the nematodes is that they are so fast that it is hard for me to get a good photo of them.  They seem to just wiz past my view and when you are looking for something the size of a few microns, a second is all you get sometimes.  I have used corn syrup before to try to slow them down as the fluid is much more viscus, it impedes their speed but I can really make a mess of the microscopes and that is not something that I want to do. 

I hope that everyone here doing this internship realize what this opportunity means and uses it to the fullest.  There are people in our fields who never get a chance to do some of the interesting individual projects that we have.  The free reign to explore our option and to collect data using anything that we can pretty much put our hands on.
I can say that this internship has really changed me and I have been lucky to have met some of the people that we have been working so closely with over the past few months.  I won't see you guys next Thursday at the conference so I want to wish you all good luck and I can't wait to see the posters when you get back.